Topic profile page for Synthesize.
This page has aggregated data from forum posts, threads, listings, online discussions, newsgroups, messageboards, and other online sources which contain user generated content for the term: Synthesize.
Topic "Synthesize" was discussed 5,607 times on 993 sites in last 3 months
Started 1 week, 1 day ago (2009-11-07 16:12:00)
by embelm_master
i'm at the point in the game where i can finally purchase Raging Gear + so i synthesized that, but now im looking ahead, and im wondering which gear is should look to synthesize after it i primarily do not cast spells except for cure and cura
Started 1 week, 4 days ago (2009-11-05 04:57:00)
by SharkOmega
...Mirage, Maria, and Sophia? And are weapons the ONLY thing you can Synthesis things into? Can you not Synthesize things into Armor or Accessories? In any case should I just spam with Orichalcums for Maria and Mirage, or what? And what should I do with my healers weapons? I have beaten the Maze of Tribulations, and I got some gauntlets from Crosell, but it seems like a really bad weapon, but ...
Started 1 week, 4 days ago (2009-11-05 04:57:00)
by Cool Shark
...Mirage, Maria, and Sophia? And are weapons the ONLY thing you can Synthesis things into? Can you not Synthesize things into Armor or Accessories? In any case should I just spam with Orichalcums for Maria and Mirage, or what? And what should I do with my healers weapons? I have beaten the Maze of Tribulations, and I got some gauntlets from Crosell, but it seems like a really bad weapon, but ...
Started 2 weeks, 4 days ago (2009-10-28 22:35:53)
by Tex
well, that's why you synthesize from a variety of sources: If you go by *only* FINRA Web pages, you can get confused. Same for *only* SEC pages. And, God forbid, you rely on what kids at brokerages tell you. Thank goodness for .edu sites...
Started 5 days, 1 hour ago (2009-11-11 04:07:00)
by Tanwa1234
Please introduce some Sound synthesizer software to me please i need one. but i don't know what's software produce good quality of sound. so please help....
Started 1 week, 1 day ago (2009-11-07 13:08:00)
by ihaveslept
Yeah i just beat the guard armor and i was thinking if i should get a new gear or if i should wait until later. Any of these? Crisis gear Hazard Rage Champion Im currently using Nimble gear+
Started 10 hours, 4 minutes ago (2009-11-15 19:24:00)
by schvitzing
Anyone watching this remake of an '83 sci-fi series? The original series was preposterous in many respects, not the least of which were 1] a ragtag group with negligible military training defeating an uber-tech alien race, 2] the inability of that uber-tech race to synthesize water from hdrogen and oxygen and 3] the brat who saved the world. Hopefully, the remake will do better. I am,...
Started 1 day, 13 hours ago (2009-11-14 15:42:00)
by cheesybagel
I bumped into this press release: http://www.greencarcongress.com/2009/11/us-navy-re searchers-synthesize-renewable-highdensity-fuel-wi th-properties-similar-to-jp10-missile-fu.html What got my attention was the article stating that RJ-5 has 1.08 g/mL density and 44.9 MJ/L. Isn't that better than RP-1?
Started 1 week ago (2009-11-08 13:43:00)
by edwardclint
The cell uses the energy derived from catabolism to fuel anabolic reactions that synthesize cell components. -quote- "ATP's energy is released when this bond is broken, turning ATP into ADP. The cell uses the energy derived from catabolism to fuel anabolic reactions that synthesize cell components. Although anabolism and catabolism occur ...
Started 1 week ago (2009-11-08 19:23:00)
by jayred
So the problem I have to answer is how to synthesize (Z)-tricos-9-ene from 1-butyne, 1-pentyne and acetylene but only using 1-pentyne and acetylene once each. I know that the acetylene will form the alkyne triple bond in the middle of the final compound and that one alkane chain attached to the triple bond will come from 2x 1-butyne + 1-pentyne, and the other chain will come from just 2x 1-butyne...
Started 5 days, 15 hours ago (2009-11-10 13:37:00)
by jmma062803
hello peps of AM can i get anyone's opinion on these PWO product, and can you guys help me pick the best one for mass gain and recovery. torrent, dark matter, evolution x10, aftermax, no synthesize and war. Thanks.
Started 5 days, 7 hours ago (2009-11-10 22:18:00)
by Jasmine
I'm making a DNA molecule, but I dont know how to start it...I know that T bonds with A as G bonds with C, but how do you synthesize the order? for example, would it just be ATGCATGCATGCATGCATGCATGCATGCAT, or is there a more accurate form to follow?
Started 1 week ago (2009-11-08 10:25:00)
by Alli M
Identify the mechanism by which the DNA double helix has all the information needed to synthesize a new strand during DNA replication? is it a nitrogenious base???
Started 5 days, 9 hours ago (2009-11-10 20:16:00)
by SharkOmega
Fury -3, 6% MP Regeneration, and 1/2 Magic Casting Speed? Need them to synthesize with final weapons. Also, are Mind Savor and Life Savor the best in their field? They do 30%, but the Tri-Emblem does 40% HP. Is there another one that does 40% or higher so I can synthesize it? Is there a 40% or higher for MP Skills?
